snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORA64
sequence
GGTCTCTCAGTTCCGCTTAACCACACGGGTCCGGTGTGTGCTTGGCGTGTTTTCACGGA
GGCAGAGAAAGGCTCTCCTAATACACGACAGACCCGCTCAGAATGGCCTCTCTGTTCCTA
GGAGTGCGACAATT
  Box motif
  Complementary to target RNA
length 133
organism Macaca_mulatta
snoRNA name SNORA64
alias
chromosome ⁄ contig 13
locus ⁄ host gene ENSMMUG00000015102
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved