snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORA53
sequence
AACATGCTTCCTTAGATCCACCTTTGTGGATGAATCTTGAACTGAGTTCCACTTGTAAA
CTTCTTGTTTCTTGTGGTTCCAGTCAAAGAAACATCCAGCAACTTTTTTGGTTGTATAGT
CAAAGGTGCTTGAGTCATTGGCATGTAAGAGAAATATACCTGCATGTTAGTCTAACGTTC
TGATAGAAATGACATGCATTTTTGCTGCCATTTGTTACTATCAGGACTCGACTCGTGTGC
GGACACT
  Box motif
  Complementary to target RNA
length 246
organism Macaca_mulatta
snoRNA name SNORA53
alias
chromosome ⁄ contig 11
locus ⁄ host gene SLC25A3
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved