snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORA43
sequence
GCTACTCTTGAACTCCTGACCTCAAGTGGTCCGCCCGCCTCGGCCTCCCAAAGTGAGAA
AGTGGCTATTTCTATCCTCAGTGTTCAGAAACCAGTGAGCACCAAAAAATGGCTTATAGC
CTGACATTT
  Box motif
  Complementary to target RNA
length 128
organism Macaca_mulatta
snoRNA name SNORA43
alias
chromosome ⁄ contig 20
locus ⁄ host gene ENSMMUG00000029170
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved