snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORA63
sequence
AAGCAAGACTCAGGCTACAATATAGCTGTTAAGTGCTGTGTTGTCATTCCCCCTGCTCA
AATTAAAGTTGTTTCTTCACTATACCCATCTGCCATTCTGGAGCAGCCAGGGATGCTTGG
TTACATACAT
  Box motif
  Complementary to target RNA
length 129
organism Macaca_mulatta
snoRNA name SNORA63
alias
chromosome ⁄ contig 1
locus ⁄ host gene C1orf102
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved