snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORD55
sequence
TGAAACTATTGAGAACAAAGATGCAACATACCACTCGAGTGTGCAGTGGGGAAGCCAAC
CTTGGAGAGCTGAGCATGTG
  Box motif
  Complementary to target RNA
length 79
organism Macaca_mulatta
snoRNA name SNORD55
alias
chromosome ⁄ contig 15
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved