snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORA26
sequence
GTGCCTAAGGTTAACACAGTGCCTTAAGAGGCTAACACAGAAGGGCAAAGTAAGTCTCC
ATAAAACCCAAAGACTCTATGAACCCCTCTCTGGATCCTGTCTGGAGTCACAGCT
  Box motif
  Complementary to target RNA
length 114
organism Macaca_mulatta
snoRNA name SNORA26
alias
chromosome ⁄ contig 13
locus ⁄ host gene Mono:167:SNORA26
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved