snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORA51
sequence
AGCCTCCTCGTGCTCAGCATAGGATATGTTATTACCCCAACCAAACAGAAAGAGGAGGC
TGAATTAACCTATCCCATATACATCTCAACCCAGGCCCTGGGACTCATCTGTATTGTCAA
TGGGGGGACATGG
  Box motif
  Complementary to target RNA
length 132
organism Macaca_mulatta
snoRNA name SNORA51
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:267:SNORA51
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved