snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORD26
sequence
CTACGGGGATGATTTTACAAACTGAACTCTCTCTTTCTGATGGATTAGTGGAGAAAACA
AAAATTCTGAGTAGC
  Box motif
  Complementary to target RNA
length 74
organism Macaca_mulatta
snoRNA name SNORD26
alias
chromosome ⁄ contig 14
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved