snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORA71
sequence
TCTTGTATCCAAAAATGGCCACGGGTTGCCTGCGCCCCGATCATTCATAGTGCAGGGGT
AGGAGTGCTAAGAGACGTTTTCCCTGCGTTGGCCCAGCCTTCCCTTTCAAACCCTGGAGC
TTTCCCATG
  Box motif
  Complementary to target RNA
length 128
organism Macaca_mulatta
snoRNA name SNORA71
alias
chromosome ⁄ contig 10
locus ⁄ host gene Poly:1:SNORA71
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved