snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORA57
sequence
CCTCATTTTCTTGACAGGAACTAGGCATGTAGTCCTACTCCCTGTTATGTACAGAGGCA
AAGGGAAGAGCTCCGGCCCCCCTTGGCATGTCTTTGGTGCCATGCAGCTTCCTGTCTGCC
AGTTCTATCCTCAAGCACCAGGACACCA
  Box motif
  Complementary to target RNA
length 147
organism Macaca_mulatta
snoRNA name SNORA57
alias
chromosome ⁄ contig 9
locus ⁄ host gene Mono:107:SNORA57
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved