snOPY snoRNA Orthological Gene Database
Macaca_mulatta SNORA24
sequence
CTCCATGTATCTTTGGAACCTGTCAGCTGTGGCAGTCGCCCTTCCTAACCATGGAAGAC
TATATTCTTGTTTACTGGCAAAGCTGTCACCATTTCATTGGTATCAGATTCTGACTTGCA
CAAGTAACATTC
  Box motif
  Complementary to target RNA
length 131
organism Macaca_mulatta
snoRNA name SNORA24
alias
chromosome ⁄ contig 1099214132604
locus ⁄ host gene Mono:22:SNORA24
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved