snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA11
sequence
GGGGTGTGCTCAGAGCAGGGGGCCTGAAGAATGGCTCTCTGTTTACAACACACCCAACA
GGAATCTGGGTTCATTGTGACAAGGGGCACAACTTGTGGCCTTCCTATAAACAATTGCCC
TACACAT
  Box motif
  Complementary to target RNA
length 126
organism Loxodonta_africana
snoRNA name SNORA11
alias
chromosome ⁄ contig GeneScaffold_2436
locus ⁄ host gene MTHFD1L
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved