snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA38
sequence
TCCTCCTACAAAGGCGTGTCTGTGGTTCCCTGTCCTTGTACACGTAAGAATTGGAGGCA
AAGAAATGTGGACTTGGAGAAGGCTGGGGCCAGCTCGCTACTTGCAGGCTCAAGCTCATC
CATCCCACATCG
  Box motif
  Complementary to target RNA
length 131
organism Loxodonta_africana
snoRNA name SNORA38
alias
chromosome ⁄ contig GeneScaffold_7417
locus ⁄ host gene ENSLAFG00000009477
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved