snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA79
sequence
TGATGACTGTTCCTCCTATTGCCTTCAGACCTGGCACTAGGATTTTAGGTCATCATAGA
TCAAAATGTGATTTTCTTCACTCAGAGAATATTAGGATAATGGGATTATCTGTCTATTCT
CTGAAATTTGTGGAATCAAACAGCT
  Box motif
  Complementary to target RNA
length 144
organism Loxodonta_africana
snoRNA name SNORA79
alias
chromosome ⁄ contig GeneScaffold_7490
locus ⁄ host gene GTF2A1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved