snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA42
sequence
CTGTGGATTTGGATTTATGGCAGGCCCATCACTGTGGGCCTCACATAGTGCCCATGTCA
GAGCAAACTGTAGCCCCAAACCATTGCCTGGCCTCCTTGCCCATAGGCTGTGGGCACTGA
AGCAGGTTGCACAGTT
  Box motif
  Complementary to target RNA
length 135
organism Loxodonta_africana
snoRNA name SNORA42
alias
chromosome ⁄ contig GeneScaffold_913
locus ⁄ host gene L2HGDH
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved