snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA63
sequence
TAGCAGGATTTAGACTACAATATAGCTGTTAAGTGCTGTGTTGTCGTTCCCCCTGCTCA
AAATAAAGTTGTTTCTTATCTATCCCTGTCTGCTAAGCCCTTGTAGCAGCCCAGGGACGC
TTGGTCTCATACAT
  Box motif
  Complementary to target RNA
length 133
organism Loxodonta_africana
snoRNA name SNORA63
alias
chromosome ⁄ contig GeneScaffold_4698
locus ⁄ host gene EIF4A2
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved