snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD48
sequence
TGATTGATGACCCCAGGTGATTCTGAGTGTCTCGCTGACGCCATCACCGCAGCGCGCTG
ACA
  Box motif
  Complementary to target RNA
length 62
organism Loxodonta_africana
snoRNA name SNORD48
alias
chromosome ⁄ contig scaffold_106580
locus ⁄ host gene C6orf48
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved