snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA56
sequence
GTGCAGACAGTTACCCCTTTCTAGTCTGGCTCCTGGGACTCTAGAGGGAGTCAGTCTGA
AATATTAAGTAGTGAACTCGTCTGTCCAGTGTCAGTGTTCATTGGCAACTTTAGACTTGC
CAAGTATCA
  Box motif
  Complementary to target RNA
length 128
organism Loxodonta_africana
snoRNA name SNORA56
alias
chromosome ⁄ contig scaffold_53154
locus ⁄ host gene DKC1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved