snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD56
sequence
CTACAATGATGGCAATATTTTTCGTCAACAGCAGTTCACCCAGTGAGTGTTGATACTTT
GGGTCTGAGTAA
  Box motif
  Complementary to target RNA
length 71
organism Loxodonta_africana
snoRNA name SNORD56
alias
chromosome ⁄ contig scaffold_47558
locus ⁄ host gene NOL5A
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved