snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA70
sequence
CTGCAGCTAGTTAAGCTGACTGGCCTACCTCCTTGATGGGGGCTCAGTGTGCAATGGCT
GCAAACAGCAGGCTCCCTGGTAGTGTGTGCAGTTCACTCCTTGTATGTGTTGCTCTAAGG
GACCTTGGAGACATCA
  Box motif
  Complementary to target RNA
length 135
organism Loxodonta_africana
snoRNA name SNORA70
alias
chromosome ⁄ contig scaffold_12810
locus ⁄ host gene TXNDC1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved