snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD45
sequence
TCGATGGTGAGATGACATGTATTCTGAACCTCAAGATTAATATTATTTTGGCTCTAGAA
TTACTCTGAGA
  Box motif
  Complementary to target RNA
length 70
organism Loxodonta_africana
snoRNA name SNORD45
alias
chromosome ⁄ contig scaffold_5986
locus ⁄ host gene RABGGTB
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved