snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD50
sequence
TATCTATGATGATCCTATCCCGAAACTGAATTTCTGTTGAAAAAACTTATACGGATCTG
GCTTCTGAGAT
  Box motif
  Complementary to target RNA
length 70
organism Loxodonta_africana
snoRNA name SNORD50
alias
chromosome ⁄ contig scaffold_18534
locus ⁄ host gene Mono:17:SNORD50
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved