snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA32
sequence
AGGTCATTACCAAGGCTTTTAGAATGCAGTTTGATTTGCTGTGGACTTGACGGTAATAA
AAACCTCCCACTAGGTTTTCTCTTTGCGACCTTGCTAGCAGTCAACCAGCTGGGAACATT
T
  Box motif
  Complementary to target RNA
length 120
organism Loxodonta_africana
snoRNA name SNORA32
alias
chromosome ⁄ contig GeneScaffold_6195
locus ⁄ host gene Mono:94:SNORA32
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved