snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA70
sequence
CTGCAGCCAATTAAGCCAACTCCCTTCCTTCCCTGTGAGGTCAACAGTGCAGTGGCTGC
AAACAGCAGCCTGCTTGGTAGTGTATGCAACCTGTTGCATGCATGCATTGCCCTAAGGAA
CCTTGGAGACAGCC
  Box motif
  Complementary to target RNA
length 133
organism Loxodonta_africana
snoRNA name SNORA70
alias
chromosome ⁄ contig scaffold_69500
locus ⁄ host gene Mono:36:SNORA70
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved