snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD74
sequence
GTGCCCTTCCTGTGATGAAACCTGTGTTGGTAGGGACATCTGAGACTTGATGAATGCCA
ACTTCTCTGATGGCAGTGC
  Box motif
  Complementary to target RNA
length 78
organism Loxodonta_africana
snoRNA name SNORD74
alias
chromosome ⁄ contig GeneScaffold_6695
locus ⁄ host gene Poly:30:SNORD81
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved