snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD113
sequence
TGGCCAAATGGTGACAGCTACTGGTGTCTGAGCCATGGTTGATGAATGGTATGTTTTTG
CAACTCTGAGGTCCAA
  Box motif
  Complementary to target RNA
length 75
organism Loxodonta_africana
snoRNA name SNORD113
alias
chromosome ⁄ contig scaffold_4770
locus ⁄ host gene Mono:4:SNORD113
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved