snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD12
sequence
GCATAGATGATGGCTGAGCTTTTTCCCCCGACAGATGGACCATGTTTATCTAACTTCTC
TAAGTCAGTTTCTGTCTGATATGC
  Box motif
  Complementary to target RNA
length 83
organism Loxodonta_africana
snoRNA name SNORD12
alias
chromosome ⁄ contig scaffold_102563
locus ⁄ host gene Mono:44:SNORD12
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved