snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD65
sequence
ACATGATGAGATAACCCAAAATAGCTGGAATTACCGGCAGAGTGTGTAGTGGTGAACCT
GTGGTTTTCTGAAG
  Box motif
  Complementary to target RNA
length 73
organism Loxodonta_africana
snoRNA name SNORD65
alias
chromosome ⁄ contig GeneScaffold_6116
locus ⁄ host gene Mono:88:SNORD65
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved