snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD95
sequence
GAGCGGTGATGATTACAACATGCCATCTGAGCATAGGTGCTGAGACCCAGAGGCTGTTT
CTGAGCTG
  Box motif
  Complementary to target RNA
length 67
organism Loxodonta_africana
snoRNA name SNORD95
alias
chromosome ⁄ contig GeneScaffold_4057
locus ⁄ host gene Mono:82:SNORD95
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved