snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD55
sequence
CGTGCATGATGACACCTCGGTAATGCTGCAAATCCCCGAGTGCGCGGTGGGGAAGCCAA
CCTTGGAGAGCTGAGCCCGCG
  Box motif
  Complementary to target RNA
length 80
organism Loxodonta_africana
snoRNA name SNORD55
alias
chromosome ⁄ contig GeneScaffold_2282
locus ⁄ host gene Poly:33:SNORD38
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved