snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD113
sequence
CGGACCAATGATGAGTACCCTGGTGGTGTCTGAATCAAGGATTTTGATTATACCCTATA
ACTCTGAGGTCTTA
  Box motif
  Complementary to target RNA
length 73
organism Loxodonta_africana
snoRNA name SNORD113
alias
chromosome ⁄ contig scaffold_4770
locus ⁄ host gene Poly:0:SNORD113
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved