snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA35
sequence
CAGCACTGGCAAAGTGGCCCATTGGGCTCCCTCTTGACCAATGGGCATCGAGCAGTGCA
AAAGCAAATCCCACCATAAAGCCGGGAGAGCCACACTGTGGGCTAACTCCTGCATGCAGG
TGGGTACATGT
  Box motif
  Complementary to target RNA
length 130
organism Loxodonta_africana
snoRNA name SNORA35
alias
chromosome ⁄ contig scaffold_5112
locus ⁄ host gene Mono:5:SNORA35
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved