snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORD73
sequence
AATAAATGATGAAAAACTGTTTCGGTCCCAGCTGATGTCCTGTGATAACTTGCATTTTT
CTGATGTT
  Box motif
  Complementary to target RNA
length 67
organism Loxodonta_africana
snoRNA name SNORD73
alias
chromosome ⁄ contig scaffold_68473
locus ⁄ host gene Poly:17:SNORD73
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved