snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA8
sequence
TGCACTGCATGGTATCTGCATTCAGCAGTTCACTCCTGCTGGGATGTTCCAAGGACAGT
GCGACAGAAATTCAGTAGCTGGCATCGTTGGTTTTCTTGGCTTTGTGCATGTTAAACCTG
GTATTTCTATTGGTACAGTT
  Box motif
  Complementary to target RNA
length 139
organism Loxodonta_africana
snoRNA name SNORA8
alias
chromosome ⁄ contig GeneScaffold_6514
locus ⁄ host gene Poly:29:SNORA1
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved