snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA9
sequence
TTGCAAGCCTCCAGCATGCTTGGGTCTGGAGTGGCCCTGTGCATTCCTCCAGTGCTTGC
CAAAAACAGTTTTGAAACGGTTTGAGGTCTCGCTCTACATCATCTACAGAGCAAGGATAT
AGAAATTTCAGACAGTT
  Box motif
  Complementary to target RNA
length 136
organism Loxodonta_africana
snoRNA name SNORA9
alias
chromosome ⁄ contig scaffold_3518
locus ⁄ host gene Mono:2:SNORA9
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved