snOPY snoRNA Orthological Gene Database
Loxodonta_africana SNORA73
sequence
CCAACGTGGATATTCCCGGGAGGTCACTCTCCCCGGGCTCTGTCCTGGTGGCGCAGGGG
AGCATAGGGCTCTGCCCCTTGATGTACAATCCCTTTCCACGACGTTGGAGATAAAGCCGG
GCCTTGAGTCTGCGCCTGCATATTCCTACAGCTTCTCAGAGTCGTGCAGACAATGACTGA
GGAGACAAACCATGCAGGAAACATGT
  Box motif
  Complementary to target RNA
length 205
organism Loxodonta_africana
snoRNA name SNORA73
alias
chromosome ⁄ contig GeneScaffold_7384
locus ⁄ host gene Poly:34:SNORA73
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved