snOPY snoRNA Orthological Gene Database
Hordeum_vulgare SNORD14
sequence
TGGCGATGATGATAAAACTTAGGCTTGTTTCTCAAAACATTCGCAGTTGCCGCCTAAGA
GCTTTCGCCCTGCCAGGCTTGAGAGCTAATGCTGCCAATTTCTTCCTTGGATGTCTGAGC
CA
  Box motif
  Complementary to target RNA
length 121
organism Hordeum_vulgare
snoRNA name SNORD14
alias
chromosome ⁄ contig chr6H
locus ⁄ host gene
organization Poly
target RNA
modification type
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved