snOPY snoRNA Orthological Gene Database
Hordeum_vulgare Plant_U3
sequence
ACGACCTTACTTGAACAGGATCTGTTCTATAGGCTCGTACCGCTGCATCCTTTACCAAT
AAGGAGGCAAGCACTTCAGTCTGGTTGATGCATTCTGACCTCTGGGCCAGAGCGTGATTA
ACGGCCAGGATTTCCCTGATGGGGCAATCCGACGGCTGTAGAGGATCGTTCCTGCCTGGC
TCACACCTGGTAGGGTGGCCCAGAGGTTGTCTGATAGACT
  Box motif
  Complementary to target RNA
length 219
organism Hordeum_vulgare
snoRNA name Plant_U3
alias
chromosome ⁄ contig chr5H
locus ⁄ host gene
organization Poly
target RNA
modification type
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved