snOPY snoRNA Orthological Gene Database
Hordeum_vulgare snoR44_J54
sequence
GAAGCAAGTGATGATAGCAAGACAGGGACATCAGAACCCTTTCAGGGTTATGACAGACT
ACGTCTATAATGGGAATCTCTCTGATGTTTT
  Box motif
  Complementary to target RNA
length 90
organism Hordeum_vulgare
snoRNA name snoR44_J54
alias
chromosome ⁄ contig chr5H
locus ⁄ host gene poly:2:snoR44_J54
organization Poly
target RNA
modification type
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved