snOPY snoRNA Orthological Gene Database
Hordeum_vulgare snoZ101
sequence
TCGATGCAGATGAGGAGACACAAGTTTATGGGCAATTTGCGTCTGTGGCATTTCTGTGA
TGCCACACTCATTTTCATCTTGGAGATCTGATGCACCCA
  Box motif
  Complementary to target RNA
length 98
organism Hordeum_vulgare
snoRNA name snoZ101
alias
chromosome ⁄ contig chr4H
locus ⁄ host gene mono:3:snoZ101
organization Mono
target RNA
modification type
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved