snOPY snoRNA Orthological Gene Database
Hordeum_vulgare snoZ266
sequence
GATTGGCTGGGATGATGATCCAATTAGATGTACGAGGGGTCACCTTATGAGCTACGACC
ATTTGAGGCATAATTTTTTTCTGACCAGCCAATC
  Box motif
  Complementary to target RNA
length 93
organism Hordeum_vulgare
snoRNA name snoZ266
alias
chromosome ⁄ contig chr4H
locus ⁄ host gene poly:snoR86
organization Poly
target RNA
modification type
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved