snOPY snoRNA Orthological Gene Database
Hordeum_vulgare snoR117
sequence
GGCCTGTGATGTGAAAATTTTGTCCGTACCATCTGATATCTTTGATGATCCACATTTGC
TAATGTATCTCTAAGGCCC
  Box motif
  Complementary to target RNA
length 78
organism Hordeum_vulgare
snoRNA name snoR117
alias
chromosome ⁄ contig chr3H
locus ⁄ host gene mono:1:snoR117
organization Mono
target RNA
modification type
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved