snOPY snoRNA Orthological Gene Database
Hordeum_vulgare snoZ119
sequence
GCTTGGAGATGATGATCATCAGAGGCTGTTTCTGAGGACGAGCCTATAGCTCTCCCTAT
GTTGCCAAATAACTGATTTGCCTATCTGATCCAAAG
  Box motif
  Complementary to target RNA
length 95
organism Hordeum_vulgare
snoRNA name snoZ119
alias
chromosome ⁄ contig chr3H
locus ⁄ host gene poly:snoZ122
organization Poly
target RNA
modification type
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved