snOPY snoRNA Orthological Gene Database
Hordeum_vulgare snoZ102_R77
sequence
AGATGATATGATGAATCAGAATAATTTCCCTATTGGTTTGATTGGCTGATATGATGGCC
TAAAATACTGAACCGAATCTGATCATCT
  Box motif
  Complementary to target RNA
length 87
organism Hordeum_vulgare
snoRNA name snoZ102_R77
alias
chromosome ⁄ contig chr2H
locus ⁄ host gene mono:snoZ102_R77
organization Mono
target RNA
modification type
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved