snOPY snoRNA Orthological Gene Database
Hordeum_vulgare snoR135
sequence
TCTGCAGGATAGGTGTGTATTGGTTAAATGCTTTTGCTCTGCATTCATTACTGAAAGTA
TTTCCTGCAATATTAATTTGAGGAAAGTGGGCAGTTGGGTTGAGCTTGATAGTCTCTTTC
GCCAACAATCATTTTCCTGTCATTT
  Box motif
  Complementary to target RNA
length 144
organism Hordeum_vulgare
snoRNA name snoR135
alias
chromosome ⁄ contig chr2H
locus ⁄ host gene HORVU2Hr1G031940
organization Intronic
target RNA
modification type
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved