snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA11
sequence
TTGTCCTGGCCTATTTTTCTGCTCCCCTGTGCTCAGTTCTAACAGGGTAGTCTGGCAGG
ACACACAGCAATTCCCTCTCAGTTTAGGAGGGCCGTCCTAAGAATAGGGCTGGCTCTTAA
AGGCACGAGAGGACAATT
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SCARNA11
alias ACA57
chromosome ⁄ contig 12
locus ⁄ host gene CHD4
organization Intronic
target RNA U5 snRNA
modification type H/ACA
modification site U5:U43
accession no AJ609487,NT_009759
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved