snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD109A
sequence
GGATCGATGATGAGAATAATTGTCTGAGGATGCTGAGGGACTCATTCCAGATGTCAATC
TGAGGTCC
  Box motif
  Complementary to target RNA
length 67
organism Homo_sapiens
snoRNA name SNORD109A
alias HBII-438A
chromosome ⁄ contig 15
locus ⁄ host gene SNRPN partial-2
organization Mono
target RNA Unknown
modification type C/D
modification site
accession no NR_001289,NR_001295
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved