snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD107
sequence
GGTTCATGATGACACAGGACCTTGTCTGAACATAATGATTTCAAAATTTGAGCTTAAAA
ATGACACTCTGAAATC
  Box motif
  Complementary to target RNA
length 75
organism Homo_sapiens
snoRNA name SNORD107
alias HBII-436
chromosome ⁄ contig 15
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no NR_001293,NR_022011
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved