snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA3
sequence
AATGGAAGCTGCTGGAACCAGCCATGTGGACAAATGAAAAAATGCCTTTTGTCTACAGA
TTGCAGCGATCCTACATAAATATATGGAGGTCTCTGTCTGGCTTAGGACAGCTGGCTAAG
TCTGATCGTTCCCCTCCGTACAGCC
  Box motif
  Complementary to target RNA
length 144
organism Homo_sapiens
snoRNA name SCARNA3
alias HBI-100
chromosome ⁄ contig 1
locus ⁄ host gene RFWD2
organization Intronic
target RNA U6 snRNA
modification type H/ACA
modification site U6:U40
accession no NR_002998 NT_004487
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved