snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA23
sequence
TGGACATTTATTTTTATTCAGTTTCTTCTCAAGGTGAAGATAACTCTTTGTAAATGTCC
TACAGAAATATAGTAGCTTTCTGTTCTTCCTTTGCAAGTAAAAAGGGTGGGTCGTTCCAC
TACTGACATTT
  Box motif
  Complementary to target RNA
length 130
organism Homo_sapiens
snoRNA name SCARNA23
alias ACA12
chromosome ⁄ contig X
locus ⁄ host gene POLA1
organization Intronic
target RNA U6 snRNA
modification type H/ACA
modification site U6:U40
accession no NR_003007 NT_167197
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved